 |
 |
|
 |
||
 |
 |
 |
|
 |
|
 |
 |
|
|
|
|
 |
|
|
|
|
|
 |
|
|
Genomic Sequencing Utilizing a RescueMu Insert:
Cycle Sequencing & Purifying Extension Products
Version #: 2
Date of last revision: 4/16/03
Author: B. Schneider
Written by: D. Morrow, B. Schneider
Stanford Genome Technology Center
Stanford University
Description:
The DNA inserts of interest are amplified using the Polymerase Chain Reaction (PCR) procedure outlined in the previous protocol. Dideoxy cycle sequencing is then performed utilizing PE Biosystems BigDye Ready Reaction Kit. The DNA cycle extension products are then purified of dye terminators and salts using Millipore Multiscreen384-SEQ plate filtering technology on the Biomek FX robotic liquid handling system. This protocol outlines the procedures for cycle sequencing and purifying the extension products in preparation for reading of sequence on the MegaBace 1000 and/or ABI Prism 3700 96-capillary DNA sequencing machines.
Notes on sequencing primers:
The primers Mu3-L and Mu3-R (see materials section below) are located at -122 from the outside end of the left (L) and right (R) terminal inverted repeats (TIRs), respectively. When using the MegaBace 1000 to sequence, the leading sequence is usually lost due to noise and excess dye-labeled ddNTP's. The primers selected are a sufficient distance from the end of the TIR to allow detection of the TIR itself as well as the 9-base pair direct repeat in the host flanking sequence. These primers also exploit four polymorphic sites within the TIRs to decrease any chances of non-specific priming when performing the forward and reverse reactions. Primers closer to the outside edge of the TIR also work in the sequencing reactions. However, identification of the 9-base pair repeat is compromised in the cases where the initial section of sequence data is difficult to interpret.
Materials and Reagents
Vendor
Stock #
GeneAmp PCR System 9700
ABI
N8050001
Falcon snap cap tubes, 5 ml
Fisher Scientific
14-959-11A
Biomek FX 20 l tips (96 per box)
Marsh
TN20R-AFX
Multiscreen384-SEQ plate
Millipore
S384SEQ50
Biomek FX liquid handling system
Beckman-Coulter
N/A
Sterile reservoirs
Matrix
8096
MicroAmp 384-well reaction plates
Perkin-Elmer/ABI
4305505
BigDye Terminator v3.0 ready reaction
cycle sequencing kit
ABI
4390244
Mu3-L Primer (from left TIR out)
AGCTGTCTCGTATCCGTTTTG
(concentration @ 3.2 pmol/l)
Operon Technologies
N/A
Mu3-R Primer (from right TIR out)
TGCTGTCTTGTGTCCGTTTTA
(concentration @ 3.2 pmol/l)
Operon Technologies
N/A
Deionized and distilled water (ddH2O)
Prepared at Genome Center
N/A
RescueMu PCR product
See PCR protocol
N/A
Hydra 96 microdispenser
Robbins Scientific Corp.
1029-40-3
MicroAmp Clear Adhesive Covers
Perkin-Elmer/ABI
4306311
Jouan CR412 Centrifuge
N/A
N/A
96-well polypropylene CyclePlate
Robbins Scientific Corp.
1055-90-0
96-well plate base
Marsh
AB-0563
Plate sealers
Edge Biosystems, Inc.
48461
Autoclaved ddH2O
Prepared at Genome Center
N/A
Procedure:
Preparing Cocktail for 5 l reaction in two 384-well plates (Left and Right directions)
- Label two Falcon tubes, two reservoirs and two 384-well plates with “Left (y)” and “Right (x)”. (In reference to the Terminal Inverted Repeat (TIR) on either side of the insert in the RescueMu plasmid, “Left” and “Right” corresponds to the relative direction of extension into the insert from the TIR during cycle sequencing.)
- Add 800 l of BigDye to each Falcon tube.
- Add 475 l of Mu3-L Primer and 475 l of Mu3-R Primer to x and y Falcon tube.
- Replace caps on tubes and invert approximately 50 times.
384-well plate Preparation
- Retrieve PCR plate and spin up to 2000 rpm for 10 seconds in a Jouan CR412 Centrifuge.
- Add appropriate tube of cocktail to each labeled reservoir.
- Dispense 3 l of cocktail into each well of labeled 384-well plates.
- Spin both 384-well plates at 2000 rpm for 20 seconds.
Addition of PCR product to separate L & R 384 plates
1) Using a Hydra 96 microdispenser, fill 20 l of autoclaved ddH2O.
- Dispense autoclaved ddH2O into quadrant 1 of PCR plate.
- Using the Wash function with a wash volume of 20 l, mix H2O/PCR mixture.
- Aspirate 2 l of H2O/PCR mixture.
- Dispense 2 l of H2O/PCR mixture into quadrant 1 of L-plate for a total volume of 5 l.
- Perform a tip rinse with ddH2O using the wash function for a few seconds and repeat steps 4-6 for the R-plate.
- Perform a dirty and clean wash with ddH2O. (A dirty wash is performed by using the volume of ddH2O used for the last clean wash. A clean wash uses a fresh volume of ddH2O to wash the syringes).
- Repeat steps 1-7 for remaining quadrants in PCR plate.
- Cover both L and R plates with MicroAmp tape and spin at 2000 rpm for 20 seconds.
- Cover PCR plate with plate sealer and store in -20 C or -80 C freezer.
- Run cycle sequencing on a GeneAmp PCR System 9700 using the following parameters for a 5 l reaction:
1.) Denaturation: 96 C for 10 seconds.
2.) Annealing: 50 C for 5 seconds.
3.) Extension: 60 C for 4 minutes.
4.) Repeat steps 1-3 35 times (approximately 2.5 hours).
5.) 4 C until ready to purify the extension products.
Purifying Extension Products
- Label four 96-well Robbins Scientific polypropylene cycle plates for each 384-well sequence plate (L and R) according to quadrant 1-4 and x or y direction (x = R; y = L).
- For each L and R reaction plate, collect two 96 count boxes of Biomek FX 20 l tips, two Millipore Multiscreen384-SEQ plates, four 96-well plate bases and the two plates of cycled sequence reactions.
- Following conditions set forth by Millipore, utilize a vacuum manifold as part of the Biomek FX liquid handling system to purify sequencing products of dye terminators and salts. Proceed to transfer purified sequencing products in solution in ddH2O into cycle plates.
- Seal plates and spin in centrifuge to remove any air bubbles prior to loading purified sequencing product.
- Attach sequencing bar-code label and store plates up to a week at -20 C until ready for loading onto MegaBACE 1000 or ABI Prism 3700 capillary array sequencing machines.